ID: 1121279349_1121279357

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1121279349 1121279357
Species Human (GRCh38) Human (GRCh38)
Location 14:92687993-92688015 14:92688030-92688052
Sequence CCCAGGCCCAGGCGCTGTGCGCG GTTCGCGGTGGAGCGGCCGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 169} {0: 1, 1: 0, 2: 0, 3: 10, 4: 72}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!