ID: 1121308515_1121308523

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1121308515 1121308523
Species Human (GRCh38) Human (GRCh38)
Location 14:92922665-92922687 14:92922712-92922734
Sequence CCTCACTCAGACAGGGGATCAAA TTGGAGAGAGCCATGAGTGATGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 17, 4: 244}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!