ID: 1121308899_1121308906

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1121308899 1121308906
Species Human (GRCh38) Human (GRCh38)
Location 14:92924120-92924142 14:92924137-92924159
Sequence CCCCAGTGAGCCCGGTCAGAAAG AGAAAGGACTGGCCTCCACTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 96} {0: 1, 1: 0, 2: 1, 3: 11, 4: 136}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!