ID: 1121316610_1121316624

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 1121316610 1121316624
Species Human (GRCh38) Human (GRCh38)
Location 14:92964662-92964684 14:92964692-92964714
Sequence CCCTTGGCCCCTCCTCCCACAGG GGAGGCTGCTGGGGTCAAACAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 49, 4: 541} {0: 1, 1: 0, 2: 2, 3: 28, 4: 288}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!