ID: 1121321225_1121321232

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1121321225 1121321232
Species Human (GRCh38) Human (GRCh38)
Location 14:92992753-92992775 14:92992790-92992812
Sequence CCTGAGTCAGACAGACCTGGCTG CACCTGAATGCTGCGTGACGTGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 6, 3: 43, 4: 266} {0: 1, 1: 0, 2: 0, 3: 5, 4: 45}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!