ID: 1121322647_1121322654

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1121322647 1121322654
Species Human (GRCh38) Human (GRCh38)
Location 14:93001483-93001505 14:93001523-93001545
Sequence CCTGTACTGAACCCAACAGGATT ACCTGGCTCCAGAAGGAGATAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 13, 4: 73} {0: 1, 1: 0, 2: 0, 3: 21, 4: 225}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!