ID: 1121323105_1121323111

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 1121323105 1121323111
Species Human (GRCh38) Human (GRCh38)
Location 14:93004189-93004211 14:93004212-93004234
Sequence CCAGCAGGAGGCACACCCTGGTG GGCAGTGGACAGCTGTGCATTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 18, 4: 201} {0: 1, 1: 0, 2: 0, 3: 24, 4: 185}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!