ID: 1121333059_1121333071

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1121333059 1121333071
Species Human (GRCh38) Human (GRCh38)
Location 14:93060005-93060027 14:93060044-93060066
Sequence CCAGGGCTTCCAGTTGCACTTGG GCAGGAGACCAGAGGGCAGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 15, 4: 239} {0: 1, 1: 3, 2: 25, 3: 127, 4: 878}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!