ID: 1121342701_1121342709

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1121342701 1121342709
Species Human (GRCh38) Human (GRCh38)
Location 14:93115039-93115061 14:93115065-93115087
Sequence CCCGGGCGCCGGCGCCGCGTCCC TTACCTGCACAGCTCGGCGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 53, 4: 429} {0: 1, 1: 0, 2: 0, 3: 1, 4: 29}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!