ID: 1121342964_1121342971

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 1121342964 1121342971
Species Human (GRCh38) Human (GRCh38)
Location 14:93115936-93115958 14:93115961-93115983
Sequence CCGCCAGGGGGCAGCGCCGCCCG GCCTCTTAAAGGCGCCGCGCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 33, 4: 266} {0: 1, 1: 0, 2: 4, 3: 2, 4: 40}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!