ID: 1121343646_1121343654

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1121343646 1121343654
Species Human (GRCh38) Human (GRCh38)
Location 14:93119494-93119516 14:93119540-93119562
Sequence CCTCTATCTTACTTCATAAGGTA GAAAATACAGCCAGGTGGGGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 133} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!