ID: 1121344405_1121344412

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1121344405 1121344412
Species Human (GRCh38) Human (GRCh38)
Location 14:93124748-93124770 14:93124783-93124805
Sequence CCAAGTAGCTGAGACCACAAGTA CCTGGCCAGGTGGTGTAATGTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 3, 3: 9, 4: 147}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!