ID: 1121359204_1121359208

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1121359204 1121359208
Species Human (GRCh38) Human (GRCh38)
Location 14:93240826-93240848 14:93240877-93240899
Sequence CCAGCGTCCCAGTGGAGTTCAAG ATTTTTTTCCTTTTTTCTGTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 100} {0: 1, 1: 5, 2: 31, 3: 489, 4: 5580}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!