ID: 1121369561_1121369567

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1121369561 1121369567
Species Human (GRCh38) Human (GRCh38)
Location 14:93344771-93344793 14:93344808-93344830
Sequence CCTGATGTGACTGGGCAGGATGA GAGAACAAGGAGATGAGGTTAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 10, 4: 150} {0: 1, 1: 0, 2: 0, 3: 43, 4: 433}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!