ID: 1121404782_1121404799

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1121404782 1121404799
Species Human (GRCh38) Human (GRCh38)
Location 14:93713036-93713058 14:93713089-93713111
Sequence CCAGCTTGCAGTGCAGAAGCTGG AGGTGGAGAGGAACCCAGACAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 28, 4: 293} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!