ID: 1121472144_1121472154

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1121472144 1121472154
Species Human (GRCh38) Human (GRCh38)
Location 14:94164350-94164372 14:94164402-94164424
Sequence CCCAAAGCCAGCACTTTTAATGA CGGTGTATGTGGAAGGTGCAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 19, 4: 244} {0: 1, 1: 0, 2: 0, 3: 15, 4: 151}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!