ID: 1121480143_1121480149

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1121480143 1121480149
Species Human (GRCh38) Human (GRCh38)
Location 14:94261237-94261259 14:94261271-94261293
Sequence CCCTCTTAAAATTGCTTTGGCCA TTGCATTTTGATATGAAGTCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 6, 3: 73, 4: 540} {0: 1, 1: 0, 2: 2, 3: 36, 4: 630}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!