ID: 1121482421_1121482423

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1121482421 1121482423
Species Human (GRCh38) Human (GRCh38)
Location 14:94289366-94289388 14:94289418-94289440
Sequence CCTGCTGATTGGCAGTTTGGAAG GCTATGTGCCAAGCCCATCTGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 2, 3: 31, 4: 117} {0: 1, 1: 0, 2: 2, 3: 8, 4: 111}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!