ID: 1121495705_1121495714

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1121495705 1121495714
Species Human (GRCh38) Human (GRCh38)
Location 14:94390240-94390262 14:94390289-94390311
Sequence CCTTCCCCTGAGCTGGCTGAATG ACAGCTCCAGCACTGGGCTGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 206} {0: 1, 1: 0, 2: 2, 3: 46, 4: 348}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!