ID: 1121510753_1121510761

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1121510753 1121510761
Species Human (GRCh38) Human (GRCh38)
Location 14:94511572-94511594 14:94511617-94511639
Sequence CCCAGAACAGGAACCGACACCAC CATTCGACTTCTCCTTTGGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 117} {0: 1, 1: 0, 2: 0, 3: 9, 4: 86}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!