ID: 1121517409_1121517417

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1121517409 1121517417
Species Human (GRCh38) Human (GRCh38)
Location 14:94561728-94561750 14:94561745-94561767
Sequence CCAGAAAAGCCTCCCCCAGGGAC AGGGACACACAGCTGGTACAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 27, 4: 275} {0: 1, 1: 0, 2: 14, 3: 132, 4: 728}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!