ID: 1121525934_1121525939

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1121525934 1121525939
Species Human (GRCh38) Human (GRCh38)
Location 14:94619330-94619352 14:94619382-94619404
Sequence CCTGCACCGTGGTGGAGCTGAAG CCTCCCTGATCAAGACAAGATGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 3, 3: 17, 4: 138} {0: 2, 1: 0, 2: 0, 3: 8, 4: 136}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!