ID: 1121535728_1121535741

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1121535728 1121535741
Species Human (GRCh38) Human (GRCh38)
Location 14:94689643-94689665 14:94689691-94689713
Sequence CCAGGGAAGCGCCGTCCCCGCAC CGTCCACAGCCCGGGCCTCTCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 127} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!