ID: 1121565937_1121565944

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1121565937 1121565944
Species Human (GRCh38) Human (GRCh38)
Location 14:94908974-94908996 14:94909021-94909043
Sequence CCATCAAGACACCAAGCTTGCAA AAGCCTGCTGACTCCAAACATGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!