ID: 1121599675_1121599698

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1121599675 1121599698
Species Human (GRCh38) Human (GRCh38)
Location 14:95194095-95194117 14:95194148-95194170
Sequence CCTCCCCTAAGCCCCTCCCTTGT GGATTGGGGTGTGCTGCTCCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 26, 4: 351} {0: 1, 1: 0, 2: 0, 3: 19, 4: 267}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!