ID: 1121607662_1121607669

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1121607662 1121607669
Species Human (GRCh38) Human (GRCh38)
Location 14:95253146-95253168 14:95253163-95253185
Sequence CCATGCCCACTGTGGCCCCTGAC CCTGACCACCCACATTGGAAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 50, 4: 556} {0: 1, 1: 0, 2: 2, 3: 16, 4: 148}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!