ID: 1121613150_1121613158

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1121613150 1121613158
Species Human (GRCh38) Human (GRCh38)
Location 14:95294749-95294771 14:95294777-95294799
Sequence CCTGGTCTTCTGGCTACTCACTG GGCCAATGGGAGGCGCTGGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 218} {0: 1, 1: 5, 2: 27, 3: 95, 4: 430}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!