ID: 1121613517_1121613520

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 1121613517 1121613520
Species Human (GRCh38) Human (GRCh38)
Location 14:95297260-95297282 14:95297298-95297320
Sequence CCACTTTTGTGCAGTCCTGCTTA GTCATTAAAAAACTGTGATAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 10, 4: 158} {0: 1, 1: 0, 2: 2, 3: 24, 4: 232}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!