ID: 1121629036_1121629040

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1121629036 1121629040
Species Human (GRCh38) Human (GRCh38)
Location 14:95409211-95409233 14:95409239-95409261
Sequence CCGCCTAGCTGGCTGCTCTGAGG TGCTGACCCTCTCCACACTCTGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 0, 3: 21, 4: 244} {0: 1, 1: 0, 2: 1, 3: 22, 4: 174}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!