ID: 1121648215_1121648226

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1121648215 1121648226
Species Human (GRCh38) Human (GRCh38)
Location 14:95535411-95535433 14:95535446-95535468
Sequence CCTCCGCCCCGGGCCCAGGAGCA GCCGAGGGGTTCCGCCGCGCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 73, 4: 837} {0: 1, 1: 0, 2: 0, 3: 1, 4: 47}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!