ID: 1121661710_1121661716

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1121661710 1121661716
Species Human (GRCh38) Human (GRCh38)
Location 14:95640081-95640103 14:95640109-95640131
Sequence CCTTCCTCATTGGGTTTCTGCAA CCCCACCCCAGCACTCTGCAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 24, 4: 329} {0: 1, 1: 0, 2: 7, 3: 64, 4: 532}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!