ID: 1121679145_1121679155

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1121679145 1121679155
Species Human (GRCh38) Human (GRCh38)
Location 14:95778235-95778257 14:95778288-95778310
Sequence CCCAAGATCTTAAATTGGCAAAC CCAGTCTGAATCGGAAGGCCTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 24, 4: 119}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!