ID: 1121694597_1121694611

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 1121694597 1121694611
Species Human (GRCh38) Human (GRCh38)
Location 14:95902620-95902642 14:95902658-95902680
Sequence CCCCAGGGGCATTTGGAAATGGG GGTAATCATGGGGATGGGGTGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 2, 3: 42, 4: 480}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!