ID: 1121697582_1121697588

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 1121697582 1121697588
Species Human (GRCh38) Human (GRCh38)
Location 14:95926361-95926383 14:95926403-95926425
Sequence CCCTGTATTGATCACAATACAAC CTTTCACCTCTCCTCTGGGAAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 21, 4: 234}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!