ID: 1121734577_1121734581

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1121734577 1121734581
Species Human (GRCh38) Human (GRCh38)
Location 14:96209033-96209055 14:96209049-96209071
Sequence CCCTGCGGGTTTCCTAAGTGGTC AGTGGTCACACTCCAGTGGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 66} {0: 1, 1: 0, 2: 0, 3: 12, 4: 118}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!