ID: 1121741098_1121741109

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 1121741098 1121741109
Species Human (GRCh38) Human (GRCh38)
Location 14:96252884-96252906 14:96252909-96252931
Sequence CCCCAGAGCCAGCACCCAGGACC TCACTTCTGGGCTGGCTGCCAGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 6, 3: 68, 4: 523} {0: 1, 1: 0, 2: 1, 3: 38, 4: 244}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!