ID: 1121744814_1121744819

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 1121744814 1121744819
Species Human (GRCh38) Human (GRCh38)
Location 14:96279806-96279828 14:96279824-96279846
Sequence CCATGTCTGGAGACGTCTTTGGC TTGGCTGTCACAACTGGGGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 38, 4: 161} {0: 3, 1: 12, 2: 79, 3: 294, 4: 592}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!