ID: 1121744814_1121744821

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 1121744814 1121744821
Species Human (GRCh38) Human (GRCh38)
Location 14:96279806-96279828 14:96279826-96279848
Sequence CCATGTCTGGAGACGTCTTTGGC GGCTGTCACAACTGGGGGAGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 38, 4: 161} {0: 2, 1: 6, 2: 36, 3: 150, 4: 559}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!