|
Left Crispr |
Right Crispr |
Crispr ID |
1121759518 |
1121759522 |
Species |
Human (GRCh38) |
Human (GRCh38) |
Location |
14:96433012-96433034
|
14:96433033-96433055
|
Sequence |
CCTTGTAGAGTTTCTGCCGAGAG |
AGGTCTGCTGTTAGTCTGATGGG |
Strand |
- |
+ |
Off-target summary |
{0: 7, 1: 24, 2: 32, 3: 38, 4: 128} |
{0: 174, 1: 1943, 2: 5321, 3: 3974, 4: 2333} |
Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
No off target data available for this pair!
|