|
Left Crispr |
Right Crispr |
| Crispr ID |
1121759518 |
1121759524 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
14:96433012-96433034
|
14:96433047-96433069
|
| Sequence |
CCTTGTAGAGTTTCTGCCGAGAG |
TCTGATGGGCTTCCCTTTGTGGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 7, 1: 24, 2: 32, 3: 38, 4: 128} |
{0: 4645, 1: 4506, 2: 1938, 3: 878, 4: 1128} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|