ID: 1121764577_1121764580

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1121764577 1121764580
Species Human (GRCh38) Human (GRCh38)
Location 14:96475067-96475089 14:96475091-96475113
Sequence CCAAGGACTCTTAAACGTAGGCC CTGGACTTTCCATTCTTTGTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 40} {0: 1, 1: 0, 2: 0, 3: 21, 4: 222}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!