ID: 1121779870_1121779878

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1121779870 1121779878
Species Human (GRCh38) Human (GRCh38)
Location 14:96615492-96615514 14:96615544-96615566
Sequence CCCGAGAGGAACACAGTATTAAC CGACTCTCCTGCCAGCCACGGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 15, 4: 121}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!