ID: 1121812527_1121812530

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1121812527 1121812530
Species Human (GRCh38) Human (GRCh38)
Location 14:96903950-96903972 14:96903963-96903985
Sequence CCAGTCTTTCTCTGTGATGCCCT GTGATGCCCTGTGTGGTTCTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 44, 4: 318} {0: 1, 1: 0, 2: 0, 3: 17, 4: 211}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!