ID: 1121827422_1121827431

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 1121827422 1121827431
Species Human (GRCh38) Human (GRCh38)
Location 14:97021867-97021889 14:97021909-97021931
Sequence CCCATGTCTACGTGCTAGTCCAC ACTCCCTTATTCCTAGAGGTGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 8, 4: 109}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!