ID: 1121829754_1121829763

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1121829754 1121829763
Species Human (GRCh38) Human (GRCh38)
Location 14:97039942-97039964 14:97039981-97040003
Sequence CCTGAATTAGATCTTCTGGGACC ATCTTGGGGTGGCTGTGTTGAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 25, 4: 252}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!