ID: 1121833179_1121833184

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 1121833179 1121833184
Species Human (GRCh38) Human (GRCh38)
Location 14:97069276-97069298 14:97069306-97069328
Sequence CCTGGGAGCCTGGGAATTGAAAA GTGTGACAACAGATGGACTGGGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!