ID: 1121835536_1121835543

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1121835536 1121835543
Species Human (GRCh38) Human (GRCh38)
Location 14:97088814-97088836 14:97088860-97088882
Sequence CCACAATTTAGTGAATTTATGAA AGGCACAGAGGATGACCTGGAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 4, 3: 36, 4: 307}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!