ID: 1121891646_1121891648

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1121891646 1121891648
Species Human (GRCh38) Human (GRCh38)
Location 14:97598962-97598984 14:97598978-97599000
Sequence CCTACAAAACAGTCCAGGCCCAG GGCCCAGTGACCTCACTAGTAGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 31, 3: 144, 4: 392} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!