ID: 1121928657_1121928659

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1121928657 1121928659
Species Human (GRCh38) Human (GRCh38)
Location 14:97952125-97952147 14:97952142-97952164
Sequence CCAGTGTAAATGCATCTCCTCTA CCTCTAACTCAACAACCCATTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 135} {0: 1, 1: 0, 2: 0, 3: 9, 4: 89}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!