ID: 1122057158_1122057162

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1122057158 1122057162
Species Human (GRCh38) Human (GRCh38)
Location 14:99108227-99108249 14:99108254-99108276
Sequence CCTCTGCCTCTCAAAGTCCTGGA CAGGTGTGAGCCACCGCCCCCGG
Strand - +
Off-target summary No data {0: 143, 1: 10091, 2: 70134, 3: 126097, 4: 153625}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!